pBZ186-pU6-(BbsI)_CBh-sv40NLS-Cas9-NLS T2A-mCherry
(Plasmid #170182)

• Purpose: Mammalian expression vector for sgRNAs cloned into the BbsI sites and for expression of spCas9 linked to mCherry via a T2A peptide
• Depositing Lab: Hunter Fraser
• Publication: Zhao et al CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065.

Backbone

• Vector backbone: Addgene Plasmid #64323
• Backbone manufacturer: Kuehn lab
• Modifications to backbone: Vector was digested by NheI and BsrGI, mCherry was amplified from Addgene plasmid # 60954 (Weissman lab) and inserted into the digested vector backbone by Gibson assembly.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Promoter: CBh
• Tags / Fusion Proteins:
  • 3XFlag (N terminal on backbone)
  • T2A (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acggatcgacctgtctcagc

Resource Information

• Supplemental Documents:
  • pBZ186-pU6-(BbsI)_CBh-sv40NLS-Cas9-NLS T2A-mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: Genes encoding SpCas9 was obtained from previously reported plasmids (Addgene plasmid # 64323, Ralf Kühn lab); mCherry was amplified from Addgene plasmid # 60954 (Jonathan Weissman lab)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry