-
PurposeExpress firefly luciferase. Used in MLV-based SARS-CoV-2 pseudovirus assay.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170575 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV IRES Luciferase
-
Backbone manufacturerfrom addgene #18760
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 7400
-
Modifications to backboneIRES changed to CMV promoter
-
Vector typeMammalian Expression, Retroviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLuc
-
Alt namefirefly luciferase
-
Speciesfirefly
-
Insert Size (bp)1600
- Promoter CMV
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer taagctagcttgccaaacctac (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymodified from addgene #18760
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-FLuc was a gift from David Nemazee (Addgene plasmid # 170575 ; http://n2t.net/addgene:170575 ; RRID:Addgene_170575) -
For your References section:
Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. Rogers TF, Zhao F, Huang D, Beutler N, Burns A, He WT, Limbo O, Smith C, Song G, Woehl J, Yang L, Abbott RK, Callaghan S, Garcia E, Hurtado J, Parren M, Peng L, Ramirez S, Ricketts J, Ricciardi MJ, Rawlings SA, Wu NC, Yuan M, Smith DM, Nemazee D, Teijaro JR, Voss JE, Wilson IA, Andrabi R, Briney B, Landais E, Sok D, Jardine JG, Burton DR. Science. 2020 Aug 21;369(6506):956-963. doi: 10.1126/science.abc7520. Epub 2020 Jun 15. 10.1126/science.abc7520 PubMed 32540903