pLentiDP1.3
(Plasmid
#171096)
-
Purposelentiviral construct (3rd generation) for the expression of cell cycle-dependent OsTIR1 fused with mEmerald and Cdt1 (AKA ROLECCS G1) and miniAID-fused mCherry2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti CMV Blast DEST (706-1)
-
Backbone manufacturerEric Campeau, Paul Kaufman
-
Modifications to backboneGateway destination removed
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOsTIR1-mEmerald-Cdt1-P2A-miniAID-mCherry2
-
SpeciesH. sapiens (human), Synthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- Emerald, cdt1, miniAID, mCherry2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTACGGTGGGAGGTCTAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypLenti CMV Blast DEST (706-1) was used as backbone (Addgene 17451). MK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as PCR template for OsTIR1; the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234; RRID:Addgene_54234) while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139) was used as template for both hGeminin and hCdt1 tags.. pDP20 was used as a template for miniAID-mCherry2
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.04.23.441203v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiDP1.3 was a gift from Dario Palmieri (Addgene plasmid # 171096 ; http://n2t.net/addgene:171096 ; RRID:Addgene_171096) -
For your References section:
A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis. Capece M, Tessari A, Mills J, Vinciguerra GLR, Louke D, Lin C, McElwain BK, Miles WO, Coppola V, Davies AE, Palmieri D, Croce CM. Cell Death Differ. 2023 Aug 3. doi: 10.1038/s41418-023-01191-4. 10.1038/s41418-023-01191-4 PubMed 37537305