pDP20
(Plasmid
#171097)
-
PurposeExpresses mAID-tagged mCherry2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry2
- Promoter CMV
-
Tag
/ Fusion Protein
- miniAID
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTACGGTGGGAGGTCTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe vector for the mAID-mCherry expression was generated using the pEGFP-C1 backbone (Clontech), replacing the GFP gene with the mAID-mCherry cassette derived from pMK292 mAID-mCherry2-NeoR (Addgene #7283033)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.04.23.441203v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDP20 was a gift from Dario Palmieri (Addgene plasmid # 171097 ; http://n2t.net/addgene:171097 ; RRID:Addgene_171097) -
For your References section:
A novel auxin-inducible degron system for rapid, cell cycle-specific targeted proteolysis. Capece M, Tessari A, Mills J, Vinciguerra GLR, Louke D, Lin C, McElwain BK, Miles WO, Coppola V, Davies AE, Palmieri D, Croce CM. Cell Death Differ. 2023 Aug 3. doi: 10.1038/s41418-023-01191-4. 10.1038/s41418-023-01191-4 PubMed 37537305