pAAV gfaABC1D Booster PKA
(Plasmid
#171119)
-
PurposeAstrocyte AAV-mediated expression of Booster-PKA, a red-shifted genetically encoded FRET biosensor for monitoring PKA activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5039
- Total vector size (bp) 7077
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBooster-PKA (from #138373)
-
Alt name4493NES
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)2038
- Promoter gfaABC1D
-
Tags
/ Fusion Proteins
- mKate2
- mKO2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMichiyuki Matsuda Lab Addgene ID#138373 The promotor is from Baljit Khakh Lab Addgene ID #52925
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Booster PKA was first described in https://pubmed.ncbi.nlm.nih.gov/32101394/ and was a gift from Michiyuki Matsuda (Addgene plasmid # 138373 ; http://n2t.net/addgene:138373 ; RRID:Addgene_138373).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV gfaABC1D Booster PKA was a gift from Thomas Oertner (Addgene plasmid # 171119)