Skip to main content

pAAV gfaABC1D Booster PKA
(Plasmid #171119)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171119 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5039
  • Total vector size (bp) 7077
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Booster-PKA (from #138373)
  • Alt name
    4493NES
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    2038
  • Promoter gfaABC1D
  • Tags / Fusion Proteins
    • mKate2
    • mKO2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michiyuki Matsuda Lab Addgene ID#138373 The promotor is from Baljit Khakh Lab Addgene ID #52925

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Booster PKA was first described in https://pubmed.ncbi.nlm.nih.gov/32101394/ and was a gift from Michiyuki Matsuda (Addgene plasmid # 138373 ; http://n2t.net/addgene:138373 ; RRID:Addgene_138373).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV gfaABC1D Booster PKA was a gift from Thomas Oertner (Addgene plasmid # 171119)