Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pThuS
(Plasmid #171674)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171674 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28b
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5293
  • Total vector size (bp) 6577
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Glycosyltransferase ThuS
  • Alt name
    ThuS
  • Species
    Bacillus thuringiensis
  • Insert Size (bp)
    1275
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pThuS was a gift from Wilfred van der Donk (Addgene plasmid # 171674 ; http://n2t.net/addgene:171674 ; RRID:Addgene_171674)
  • For your References section:

    Structural and mechanistic investigations of protein S-glycosyltransferases. Fujinami D, Garcia de Gonzalo CV, Biswas S, Hao Y, Wang H, Garg N, Lukk T, Nair SK, van der Donk WA. Cell Chem Biol. 2021 Dec 16;28(12):1740-1749.e6. doi: 10.1016/j.chembiol.2021.06.009. Epub 2021 Jul 21. 10.1016/j.chembiol.2021.06.009 PubMed 34283964