Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
(Plasmid #172317)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEG302
  • Backbone size w/o insert (bp) 15826
  • Total vector size (bp) 21241
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    g18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
  • Alt name
    dMQ1
  • Species
    Mollicutes Spiroplasma
  • Insert Size (bp)
    13669

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ATTTCTATCTAGATCTGGTGTT
  • 3′ sequencing primer TAAGGATCTGAGCTACACATGCTCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18 was a gift from Steven Jacobsen (Addgene plasmid # 172317 ; http://n2t.net/addgene:172317 ; RRID:Addgene_172317)
  • For your References section:

    CRISPR-based targeting of DNA methylation in Arabidopsis thaliana by a bacterial CG-specific DNA methyltransferase. Ghoshal B, Picard CL, Vong B, Feng S, Jacobsen SE. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23):e2125016118. doi: 10.1073/pnas.2125016118. 10.1073/pnas.2125016118 PubMed 34074795