pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
(Plasmid
#172318)
-
PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAs
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEG302
- Backbone size w/o insert (bp) 7570
- Total vector size (bp) 27502
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
-
Alt nameSunTag-MQ1v
-
SpeciesA. thaliana (mustard weed); Mollicutes Spiroplasma
-
Insert Size (bp)19930
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (unknown if destroyed)
- 3′ cloning site BsiWI (unknown if destroyed)
- 5′ sequencing primer GGCAGACAAACAAAAGAATGG
- 3′ sequencing primer GTGGTGGTTTCACCTTTCAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18 was a gift from Steven Jacobsen (Addgene plasmid # 172318 ; http://n2t.net/addgene:172318 ; RRID:Addgene_172318) -
For your References section:
CRISPR-based targeting of DNA methylation in Arabidopsis thaliana by a bacterial CG-specific DNA methyltransferase. Ghoshal B, Picard CL, Vong B, Feng S, Jacobsen SE. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23):e2125016118. doi: 10.1073/pnas.2125016118. 10.1073/pnas.2125016118 PubMed 34074795