pM423
(Plasmid #172408)

• Purpose: Expresses sfGFP (1-10) and MCP-GFP11
• Depositing Lab: Hajin Kim
• Publication: Chaudhary et al Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4.

Backbone

• Vector backbone: pHAGE-DEST
• Backbone size w/o insert (bp): 6450
• Total vector size (bp): 8868
• Modifications to backbone: TetO deletion
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCP, bipartite sfGFP
• Species: Synthetic
• Insert Size (bp): 392
• Promoter: hPGK
• Tag / Fusion Protein:
  • sfGFP {1-10} (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cctcgttgaccgaatcaccg
• 3′ sequencing primer: agttaagaataccagtcaatctttcac

Resource Information

• Supplemental Documents:
  • pM423.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Soluble bipartite sfGFP system expressing MCP-GFP11 and GFP1-10.