1
Plasmid 17261: pCGB42/Kan
  • None

  • B42•HA

  • N terminal on backbone

  • pPC16
    (Search Vector Database)

  • Yeast Expression

  • 6500

  • EcoRI

  • No

  • SacII

  • No

  • CCAGCCTCTTGCTGAGTGGAGATG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Geneticin (G418)

  • View sequences (1)
  • View map

  • Stuart Schreiber

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang et al (Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17261" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with