p2GB42/Kan
(Plasmid #17260)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pJG4-5
  • Backbone size (bp) 7390
  • Vector type
    Yeast Expression
  • Selectable markers
    Geneticin (G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • B42•HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCAGCCTCTTGCTGAGTGGAGATG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

ref for pJG4-5: Gyuris, J., Golemis, E., Chertkov, H. & Brent, R. (1993) Cell 75, 791-803.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2GB42/Kan was a gift from Stuart Schreiber (Addgene plasmid # 17260)
  • For your References section:

    A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang J, Schreiber SL. Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. 10.1073/pnas.94.25.13396 PubMed 9391035