pAX198
(Plasmid
#173042)
-
PurposeCustom vector for sgRNA library construction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-sgRNA EF1Alpha-puro-T2A-BFP
- Total vector size (bp) 9259
-
Modifications to backboneInsert HBB target region
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR
-
gRNA/shRNA sequencesgGFP-NT2
-
SpeciesH. sapiens (human)
-
Entrez GeneHBB (a.k.a. CD113t-C, ECYT6, beta-globin)
- Promoter mouse U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagcacaaaaggaaactcacc
- 3′ sequencing primer CACCGGTTCAATTGCCGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAX198 was a gift from Brittany Adamson (Addgene plasmid # 173042 ; http://n2t.net/addgene:173042 ; RRID:Addgene_173042) -
For your References section:
Mapping the genetic landscape of DNA double-strand break repair. Hussmann JA, Ling J, Ravisankar P, Yan J, Cirincione A, Xu A, Simpson D, Yang D, Bothmer A, Cotta-Ramusino C, Weissman JS, Adamson B. Cell. 2021 Oct 28;184(22):5653-5669.e25. doi: 10.1016/j.cell.2021.10.002. Epub 2021 Oct 20. 10.1016/j.cell.2021.10.002 PubMed 34672952