pTM-BPL
(Plasmid #173766)

• Purpose: Fluorescent labeling of the nuclear envelope
• Depositing Lab: Shinji Sueda
• Publication: Taniyama et al ACS Chem Biol. 2018 Jun 15;13(6):1463-1469. doi: 10.1021/acschembio.8b00219. Epub 2018 May 24.

Backbone

• Vector backbone: pCI-neo vector
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5439
• Total vector size (bp): 6449
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PDGF receptor TM domain, Biotin protein ligase
• Alt name: BPL
• Species: Synthetic
• Insert Size (bp): 1010
• GenBank ID:
• Promoter: CMV
• Tags / Fusion Proteins:
  • Signal peptide (N terminal on backbone)
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: AATTAACCCTCACTAAAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry