pBCCP-GFP-NLS
(Plasmid #173923)

• Purpose: Fluorescent labeling of the nuclear envelope
• Depositing Lab: Shinji Sueda
• Publication: Taniyama et al ACS Chem Biol. 2018 Jun 15;13(6):1463-1469. doi: 10.1021/acschembio.8b00219. Epub 2018 May 24.

Backbone

• Vector backbone: pQBI 25-fA1
• Backbone manufacturer: FUJIFILM Wako Chemicals U.S.A. Corporation
• Backbone size w/o insert (bp): 5484
• Total vector size (bp): 6543
• Modifications to backbone: Deletion of the GFP coding sequence
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Biotin carboxyl carrier protein, AcGFP1
• Alt name: BCCP
• Species: Synthetic
• Insert Size (bp): 1060
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xNLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TATTTAGGTGACACTATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry