pUFlip-floxed2A-mRFP-; gcry1:BFP -1
(Plasmid
#173887)
-
PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld method
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepK
-
Backbone manufacturerKarl J. Clark
- Backbone size w/o insert (bp) 2730
- Total vector size (bp) 7589
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2A-mRFP; gcry1: BFP
-
Alt nameP2A-monomeric RFP gamma crystallin 1: BFP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)4859
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
- 3′ sequencing primer atggctcataacaccccttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUFlip-floxed2A-mRFP-; gcry1:BFP -1 was a gift from Jeffrey Essner (Addgene plasmid # 173887 ; http://n2t.net/addgene:173887 ; RRID:Addgene_173887) -
For your References section:
Cre/lox regulated conditional rescue and inactivation with zebrafish UFlip alleles generated by CRISPR-Cas9 targeted integration. Liu F, Kambakam S, Almeida MP, Ming Z, Welker JM, Wierson WA, Schultz-Rogers LE, Ekker SC, Clark KJ, Essner JJ, McGrail M. Elife. 2022 Jun 17;11. pii: 71478. doi: 10.7554/eLife.71478. 10.7554/eLife.71478 PubMed 35713402