pSBtet-RB-PE2
(Plasmid #173903)

• Purpose: SB-transposon with inducible expression of SpCas9 PE2
• Depositing Lab: Ronald Cohn
• Publication: Prime editing plasmids (unpublished)

Backbone

• Vector backbone: pSBtet-RB
• Backbone manufacturer: Kowarz Lab (Addgene Plasmid #60506)
• Backbone size w/o insert (bp): 2021
• Total vector size (bp): 8375
• Modifications to backbone: PE2 inserted between SfiI restriction sites
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PE2
• Alt name: Cas9(H840A)-M-MLVrt(D200N, T306K, W313F, T330P, L603W)
• Species: Synthetic
• Insert Size (bp): 6354
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on backbone)
  • SV40 NLS (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCTGGAGCCAATTCCAACTCT
• 3′ sequencing primer: CACTGCATTCTTGTTGTGGTT

Resource Information

• Supplemental Documents:
  • tet-PE2.gb
• A portion of this plasmid was derived from a plasmid made by: PE2 insert was cloned from pCMV-PE2 (Addgene Plasmid #132775)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry