pJL29
(Plasmid #174063)

• Purpose: Expresses for mCherry for S. cerevisiae. Contain 2 43-8 zinc-finger operators upstream of Cyc1 promoter.
• Depositing Lab: Albert Keung
• Publication: Lee et al Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003.

Backbone

• Vector backbone: unknown
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2x43-8 ZFO-1x97-4 ZFO pCyc mCherry tCyc
• Species: S. cerevisiae (budding yeast), Synthetic
• Promoter: pCyc1
• Tag / Fusion Protein:
  • FLAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (unknown if destroyed)
• 3′ cloning site: EagI (unknown if destroyed)
• 5′ sequencing primer: cgactcactatagggcgaattg
• 3′ sequencing primer: unknown

Resource Information

• Supplemental Documents:
  • pJL29.ape
• A portion of this plasmid was derived from a plasmid made by: Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.