pJL15
(Plasmid
#174069)
-
PurposeExpresses 43-8 zinc finger array fused to CRY2 in S. cerevisiae. Part of optogenetic system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepGAL-tetO-3xNLS-43-8WT-GS-Cry2-Tadh1
-
SpeciesS. cerevisiae (budding yeast), A. thaliana (mustard weed), Synthetic
- Promoter pGal1
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer unknown
- 3′ sequencing primer catcgcgttaattaatagacaactc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byKennedy, M.J., Hughes, R.M., Peteya, L.A., Schwartz, J.W., Ehlers, M.D., and Tucker, C.L. (2010). Rapid blue-light-mediated induction of protein interactions in living cells. Nature Methods 7, 973-U948. 10.1038/nmeth.1524. Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL15 was a gift from Albert Keung (Addgene plasmid # 174069 ; http://n2t.net/addgene:174069 ; RRID:Addgene_174069) -
For your References section:
Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745