Gene Trap - 24XMS2 Lentiviral Vector
(Plasmid
#174198)
-
PurposeLentiviral expression vector coding for Blasticidin, iRFP and 24X MS2 hairpins. All inserts are cloned in on the -strand to allow for splicing in when targeted into an intron of transcribed genes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentivector
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiRFP
-
SpeciesSynthetic
-
Tags
/ Fusion Proteins
- Blasticidin
- T2A
- 24X MS2 hairpins
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer CATggcgcgcctagggccg
- 3′ sequencing primer CCCGGGCCTCTCACTCTCTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The inserts are cloned between NheI/BsrGI in reverse order on the -strand as follows:
NheI - 24XMS2 - FRT - BGH p(A) - Blasticidin - T2A - iRFP - Splice Acceptor - FRT - BsrGI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gene Trap - 24XMS2 Lentiviral Vector was a gift from Daniel Larson (Addgene plasmid # 174198 ; http://n2t.net/addgene:174198 ; RRID:Addgene_174198) -
For your References section:
Dynamic imaging of nascent RNA reveals general principles of transcription dynamics and stochastic splice site selection. Wan Y, Anastasakis DG, Rodriguez J, Palangat M, Gudla P, Zaki G, Tandon M, Pegoraro G, Chow CC, Hafner M, Larson DR. Cell. 2021 May 27;184(11):2878-2895.e20. doi: 10.1016/j.cell.2021.04.012. Epub 2021 May 11. 10.1016/j.cell.2021.04.012 PubMed 33979654