Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti CMV/TO GFP-Zeo DEST (719-1)
(Plasmid #17431)


Item Catalog # Description Quantity Price (USD)
Plasmid 17431 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.


  • Vector backbone
    p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  • Backbone size (bp) 10140
  • Vector type
    Mammalian Expression, Lentiviral ; Destination vector
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    DB3.1 or ccDB survival, 37oC
  • Copy number
    High Copy


  • Gene/Insert name

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cggctcgtataatgtgtgga
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.

Information for Cloning Grade DNA (Catalog # ( Back to top )


Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.


  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV/TO GFP-Zeo DEST (719-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17431 ; ; RRID:Addgene_17431)
  • For your References section:

    A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394