-
Purpose(Empty Backbone) 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter, GFP-Zeo
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 17431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
Cloning Grade DNA | 17431-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $95 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep156RRL-sinPPT-CMV-GFP-PRE/Nhe I
- Backbone size (bp) 10140
-
Vector typeMammalian Expression, Lentiviral ; Destination vector
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDB3.1 or ccDB survival, 37oC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cggctcgtataatgtgtgga
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.
Information for Cloning Grade DNA (Catalog # 17431-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $95 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CMV/TO GFP-Zeo DEST (719-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17431 ; http://n2t.net/addgene:17431 ; RRID:Addgene_17431) -
For your References section:
A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394