PB-PE NG
(Plasmid
#174554)
-
PurposeAll-in-one prime editor piggyBac transposon, NG variant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEX-A2
-
Backbone manufacturerEurofins Genomics
- Backbone size w/o insert (bp) 5120
- Total vector size (bp) 13136
-
Modifications to backboneaddition of 3' and 5' piggyBac repeats, addition of pU6-pegRNA(B12B) sequence, addition of CAG promoter, addition of bGH (pA)
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology ; piggyBac transposon
-
Selectable markersPuromycin ; thymidine kinase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsIt is highly recommended to use NEB Stable at 30°C. Cloning efficiency and stability of plasmid can be compromised when using other strains / higher temperatures!
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9 NG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
-
SpeciesSynthetic
-
Insert Size (bp)8016
-
MutationL1111R, G1218R, E1219F, A1322R, R1335V, T1337R
- Promoter CAG
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAGAATTGATAGCGGCCGCTAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCas9 NG was PCR amplified from pX330-SpCas9-NG (Addgene #117919)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-PE NG was a gift from Tobias Cantz (Addgene plasmid # 174554 ; http://n2t.net/addgene:174554 ; RRID:Addgene_174554) -
For your References section:
A selectable all-in-one CRISPR prime editing piggyBac transposon allows for highly efficient gene editing in human cell lines. Eggenschwiler R, Gschwendtberger T, Felski C, Jahn C, Langer F, Sterneckert J, Hermann A, Luhmann J, Steinemann D, Haase A, Martin U, Petri S, Cantz T. Sci Rep. 2021 Nov 12;11(1):22154. doi: 10.1038/s41598-021-01689-2. 10.1038/s41598-021-01689-2 PubMed 34773059