pDRM210 LGP (Luciferase GFP Puro)
(Plasmid
#174722)
-
PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRLSIN.cPPT.MND
- Backbone size w/o insert (bp) 6685
- Total vector size (bp) 9863
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirefly Luciferase
-
Alt nameLuc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1650
- Promoter MND
-
Tag
/ Fusion Protein
- E2A linker (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer MND-F (GTTCGCTTCTCGCTTCTGTT) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Alt nameEnhanced Green Fluorescent Protein
-
SpeciesAequorea victoria
-
Insert Size (bp)717
- Promoter MND (off Luc-E2A)
-
Tag
/ Fusion Protein
- F2A linker (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer Luc-F (GACGAAGTACCGAAAGGTCTT) (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepac
-
Alt namepuromycin acetyl transferase/ PuroR
-
SpeciesStreptomyces alboniger
-
Insert Size (bp)600
- Promoter MND (off Luc-E2A-eGFP-F2A)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer WPRE-R (GCGTAAAAGGAGCAACATAG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRM210 LGP (Luciferase GFP Puro) was a gift from Wayne Tilley (Addgene plasmid # 174722 ; http://n2t.net/addgene:174722 ; RRID:Addgene_174722) -
For your References section:
Selective inhibition of CDK9 in triple negative breast cancer. Mustafa EH, Laven-Law G, Kikhtyak Z, Nguyen V, Ali S, Pace AA, Iggo R, Kebede A, Noll B, Wang S, Winter JM, Dwyer AR, Tilley WD, Hickey TE. Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3. 10.1038/s41388-023-02892-3 PubMed 38001268