AAV-TRE-NS1NF
(Plasmid
#175279)
-
PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17D
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 3901
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNS1
-
SpeciesYellow fever virus strain 17D
-
Insert Size (bp)1133
-
Entrez GenePOLY (a.k.a. YFVgp1)
- Promoter tight TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtatgtcgaggtaggcgtgtacgg
- 3′ sequencing primer aggacaaggctggtgggcactgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-TRE-NS1NF was a gift from Wei Xu (Addgene plasmid # 175279 ; http://n2t.net/addgene:175279 ; RRID:Addgene_175279) -
For your References section:
Anterograde transneuronal tracing and genetic control with engineered yellow fever vaccine YFV-17D. Li E, Guo J, Oh SJ, Luo Y, Oliveros HC, Du W, Arano R, Kim Y, Chen YT, Eitson J, Lin DT, Li Y, Roberts T, Schoggins JW, Xu W. Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9. 10.1038/s41592-021-01319-9 PubMed 34824475