pJH2972
(Plasmid
#175285)
-
PurposePmyo-3 GFP::DAF-16a unc-54 3' UTR C.elegans muscle expression of isoforms a of DAF-16
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBSK
- Backbone size w/o insert (bp) 6288
- Total vector size (bp) 9929
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDAF-16a
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)2550
-
Entrez Genedaf-16 (a.k.a. CELE_R13H8.1)
- Promoter Pmyo-3
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATGATGGAGATGCTGGTAGATCAG
- 3′ sequencing primer GGGCAGCATATTCATTTTGATTTGTAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH2972 was a gift from Mei Zhen (Addgene plasmid # 175285 ; http://n2t.net/addgene:175285 ; RRID:Addgene_175285) -
For your References section:
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication. Hung WL, Wang Y, Chitturi J, Zhen M. Development. 2014 Apr;141(8):1767-79. doi: 10.1242/dev.103846. Epub 2014 Mar 26. 10.1242/dev.103846 PubMed 24671950