BPK1520_blastR
(Plasmid
#175289)
-
Purpose(Empty Backbone) Human expression plasmid for SpCas9 sgRNA with blasticidin co-selection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBPK1520
-
Backbone manufacturerJoung Lab (Addgene Plasmid #65777)
- Backbone size (bp) 2280
-
Vector typeMammalian Expression, CRISPR
- Promoter CMV/U6
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer cggagcctatggaaaaacgccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypSBbi-RB (Addgene #60522)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BPK1520_blastR was a gift from Ronald Cohn (Addgene plasmid # 175289 ; http://n2t.net/addgene:175289 ; RRID:Addgene_175289)