pTS26_QUAS_CsChrimson
(Plasmid
#175548)
-
PurposeExpresses the optogenetic channel CsChrimson off of a QUAS promoter and contains Piggybac terminal repeats for transposon-mediated integration
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXL-BacII
-
Backbone manufacturerOlena Riabinina, Darya Task, Elizabeth Marr, Chun-Chieh Lin, Robert Alford, David A. O'Brochta & Christopher J. Potter
- Backbone size w/o insert (bp) 6637
- Total vector size (bp) 9233
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsChrimson
-
SpeciesChloromonas subdivisa
-
Insert Size (bp)3289
-
GenBank IDKF992078
- Promoter QUAS
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCGAGCAAAATGAGCAGACTGGTCGCCGCTTC
- 3′ sequencing primer ATCCTCTAGAttacacctcgttctcgtagcagaaTTTATACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe CsChrimson plasmid p20X was shared by Vivek Jayaraman
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTS26_QUAS_CsChrimson was a gift from Leslie Vosshall (Addgene plasmid # 175548 ; http://n2t.net/addgene:175548 ; RRID:Addgene_175548)