pSA10(gfcB-His-CD)
(Plasmid #176194)

• Purpose: expresses 3 overlapping genes (gfcB-6xHis, gfcC, gfcD) from this one operon
• Depositing Lab: Mark Saper
• Publication: Larson et al PLoS One. 2021 Nov 15;16(11):e0259900. doi: 10.1371/journal.pone.0259900. eCollection 2021.

Backbone

• Vector backbone: pSA10
• Backbone manufacturer: from Dr Shoshi Altuvia
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: gfcBCD
• Species: E. coli E2348/69 O127:H6
• Promoter: Ptac
• Tag / Fusion Protein:
  • GfcB-6xHis (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: GCTCGTATAATGTGTGGAATTG
• 3′ sequencing primer: CGATGGTGTCAACGTAAATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert is a contiguous set of genes gfcB, gfcC, gfcD. All 3 proteins are expressed with their native signal sequences. Derived from plasmid pSA10(gfcBCD) [Addgene #176193] by mutagenesis to include a 6xHis tag on the C-term of GfcB.