Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRedCm
(Plasmid #176225)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176225 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-30
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The plasmid confers resistance to chloramphenicol only in absence of CI repressor of lambda phage.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
  • Promoter PrhaB and PL

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctttttgcgtttctacaaactc
  • 3′ sequencing primer tggactcaagacgatagttac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRedCm was a gift from Sergey Sineoky (Addgene plasmid # 176225 ; http://n2t.net/addgene:176225 ; RRID:Addgene_176225)
  • For your References section:

    Robust counterselection and advanced lambdaRed recombineering enable markerless chromosomal integration of large heterologous constructs. Bubnov DM, Yuzbashev TV, Khozov AA, Melkina OE, Vybornaya TV, Stan GB, Sineoky SP. Nucleic Acids Res. 2022 Aug 26;50(15):8947-8960. doi: 10.1093/nar/gkac649. 10.1093/nar/gkac649 PubMed 35920321