Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pML433
(Plasmid #177190)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177190 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HyPro enzyme
  • Alt name
    APEX2 - DIG10.3 fusion protein
  • Species
    Synthetic
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

E. coli codon-optimized versions of APEX2 and DIG10.3 genes from https://pubmed.ncbi.nlm.nih.gov/25419960/ and https://pubmed.ncbi.nlm.nih.gov/24005320/, respectively, were fused in frame via the (GGGGS)3 linker sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pML433 was a gift from Eugene Makeyev (Addgene plasmid # 177190 ; http://n2t.net/addgene:177190 ; RRID:Addgene_177190)
  • For your References section:

    Hybridization-proximity labeling reveals spatially ordered interactions of nuclear RNA compartments. Yap K, Chung TH, Makeyev EV. Mol Cell. 2021 Nov 2. pii: S1097-2765(21)00838-8. doi: 10.1016/j.molcel.2021.10.009. 10.1016/j.molcel.2021.10.009 PubMed 34741808