Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mouse Clock delta 19
(Plasmid #177312)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177312 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 2412
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mouse clock delta 19
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2412
  • Mutation
    deletion from original mClock gene (514-564aa)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer pcDNA reverse primer
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse Clock delta 19 was a gift from Joseph Takahashi (Addgene plasmid # 177312 ; http://n2t.net/addgene:177312 ; RRID:Addgene_177312)
  • For your References section:

    Positional cloning of the mouse circadian clock gene. King DP, Zhao Y, Sangoram AM, Wilsbacher LD, Tanaka M, Antoch MP, Steeves TD, Vitaterna MH, Kornhauser JM, Lowrey PL, Turek FW, Takahashi JS. Cell. 1997 May 16;89(4):641-53. doi: 10.1016/s0092-8674(00)80245-7. 10.1016/s0092-8674(00)80245-7 PubMed 9160755