pLV-hSyn1-GFP
(Plasmid
#177810)
-
PurposeEncodes a GFP driven by human synapsin I promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177810 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 9210
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCopGFP inserted behind human synapsin I promoter
-
Alt nameSYN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)699
- Promoter Syn1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer agtcgtgtcgtgcctgagag
- 3′ sequencing primer tgttgctccttttacgctatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVector derived from pLV-hSyn-RFP (Addgene Plasmid #22909)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-hSyn1-GFP was a gift from Christopher Grigsby (Addgene plasmid # 177810 ; http://n2t.net/addgene:177810 ; RRID:Addgene_177810) -
For your References section:
Enhanced efficiency of nonviral direct neuronal reprogramming on topographical patterns. Mattiassi S, Rizwan M, Grigsby CL, Zaw AM, Leong KW, Yim EKF. Biomater Sci. 2021 Aug 7;9(15):5175-5191. doi: 10.1039/d1bm00400j. Epub 2021 Jun 15. 10.1039/d1bm00400j PubMed 34128504