Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1_Puro_hPGK1_EBFP_Donor
(Plasmid #178089)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 6449
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EBFP (T65S/F145Y)
  • Species
    H. sapiens (human)
  • Promoter Human PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer TAGTGTGGGCCCTGTTCCTG
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid derived from AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene 68375). Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_Puro_hPGK1_EBFP_Donor was a gift from Yannick Doyon (Addgene plasmid # 178089 ; http://n2t.net/addgene:178089 ; RRID:Addgene_178089)
  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338