pLKO.1-PTPA-2
(Plasmid
#179369)
-
PurposeshRNA suppression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePR53
-
gRNA/shRNA sequenceGATCCACACAGTTCCAGACAT
-
SpeciesH. sapiens (human)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-PTPA-2 was a gift from William Hahn (Addgene plasmid # 179369 ; http://n2t.net/addgene:179369 ; RRID:Addgene_179369) -
For your References section:
Identification of PP2A complexes and pathways involved in cell transformation. Sablina AA, Hector M, Colpaert N, Hahn WC. Cancer Res. 2010 Dec 15;70(24):10474-84. doi: 10.1158/0008-5472.CAN-10-2855. 10.1158/0008-5472.CAN-10-2855 PubMed 21159657