Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

JEC027
(Bacterial strain #180310)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Bacterial Strain 180310 Bacteria in agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    n/a

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli MG1655ΔCRISPR-Cas
  • Growth instructions
    LB with no antibiotics
  • Copy number
    Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genotype: E. coli MG1655ΔCRISPR-Cas
Method: Knockout using pKD46/pKD4
Created by: Baiyang Liu
Knockout region from MG1655 genome: 995605 to 1006007
Primer Fw: GATTATCGACTGGGATAACC
Primer Rv: CAGAAATATTCGACAAAGCG
Expected PCR size for JEC027: 1kb
Expected PCR size for MG1655: 10.4kb

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JEC027 was a gift from James Chappell (Addgene plasmid # 180310)
  • For your References section:

    Uncovering the Distinct Properties of a Bacterial Type I-E CRISPR Activation System. Villegas Kcam MC, Tsong AJ, Chappell J. ACS Synth Biol. 2022 Jan 25. doi: 10.1021/acssynbio.1c00496. 10.1021/acssynbio.1c00496 PubMed 35077145