Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-gRNA-puro
(Plasmid #180426)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180426 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti_puro
  • Backbone size w/o insert (bp) 6487
  • Total vector size (bp) 6960
  • Modifications to backbone
    The CMV promoter in the original pLenti-puro (Addgene #39481) was removed with the restriction enzymes ClaI and BamHI followed by blunting and self-ligation.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNAscr
  • Alt name
    Universal mammalian negative control (scrambled) gRNA
  • gRNA/shRNA sequence
    GCACTACCAGAGCTAACTCA
  • Insert Size (bp)
    467
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer BGH-reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid backbone was pLenti-puro (Addgene #39481) with the CMV promoter removed by ClaI and BamHI double digest followed by blunting and self-ligation/circularization. gRNA scaffold sequence was obtained from Prashant Mali et al (Science, 2013) and made by gene synthesis, TA-cloning into pCR™ 2.1-TOPO™ TA vector, and transfer to modified pLenti-puro using EcoRI.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-gRNA-puro was a gift from Moshe Szyf (Addgene plasmid # 180426 ; http://n2t.net/addgene:180426 ; RRID:Addgene_180426)
  • For your References section:

    Unraveling the functional role of DNA demethylation at specific promoters by targeted steric blockage of DNA methyltransferase with CRISPR/dCas9. Sapozhnikov DM, Szyf M. Nat Commun. 2021 Sep 29;12(1):5711. doi: 10.1038/s41467-021-25991-9. 10.1038/s41467-021-25991-9 PubMed 34588447