1
Plasmid 18115: pMXs-hNANOG (Plath)
  • Nanog homeobox

  • NANOG

  • 918

  • H. sapiens (human)

  • NANOG ()

  • n/a

  • PMXs
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 4622

  • EcoRI

  • No

  • Not I

  • No

  • cctctagactgccggatctagcta List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • pMXs is originally from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.

  • View sequences (2)
  • View map

  • Kathrin Plath

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Generation of human induced pluripotent stem cells from dermal fibroblasts. Lowry et al (Proc Natl Acad Sci U S A. 2008 Feb 26. 105(8):2883-8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18115" in your Materials and Methods section.