Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-shMcu-1
(Plasmid #181868)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 181868 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-U6_CAG-hrGFP
  • Vector type
    Mammalian Expression, Mouse Targeting, Adenoviral, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mitochondrial calcium uniporter
  • Alt name
    MCU
  • gRNA/shRNA sequence
    TAGGGAATAAAGGGATCTTA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001033259.4
  • Entrez Gene
    Mcu (a.k.a. 2010012O16Rik, C10orf42, Ccdc109a, D130073L02Rik, Gm64)
  • Promoter U6
  • Tag / Fusion Protein
    • hrGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TTGGGTAGTTTGCAGTTTTAAAATT
  • 3′ sequencing primer TCACTGAGGAAGCTCTCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-shMcu-1 was a gift from Hilmar Bading (Addgene plasmid # 181868 ; http://n2t.net/addgene:181868 ; RRID:Addgene_181868)
  • For your References section:

    Mitochondrial calcium uniporter Mcu controls excitotoxicity and is transcriptionally repressed by neuroprotective nuclear calcium signals. Qiu J, Tan YW, Hagenston AM, Martel MA, Kneisel N, Skehel PA, Wyllie DJ, Bading H, Hardingham GE. Nat Commun. 2013;4:2034. doi: 10.1038/ncomms3034. 10.1038/ncomms3034 PubMed 23774321