Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ttAtCas12a+int
(Plasmid #182384)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182384 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    GoldenGate level 0
  • Backbone size w/o insert (bp) 2247
  • Total vector size (bp) 6921
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCas12a coding sequence with D156R and Arabidopsis introns
  • Species
    A. thaliana (mustard weed); Lachnospiraceae bacterium
  • Insert Size (bp)
    4674
  • Mutation
    D156R + 8 Arabidopsis introns added
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer TCACATGTTCTTTCCTGCG
  • 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ttAtCas12a+int was a gift from Wendy Harwood (Addgene plasmid # 182384 ; http://n2t.net/addgene:182384 ; RRID:Addgene_182384)
  • For your References section:

    Highly efficient genome editing in barley using novel LbCas12a variants and impact of sgRNA architecture. Lawrenson T, Hinchliffe A, Forner M, Harwood W. bioRxiv 2022.04.28.489853 10.1101/2022.04.28.489853