Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro
(Plasmid #183410)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB510B-1
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 4422
  • Total vector size (bp) 13019
  • Modifications to backbone
    The CMV promoter (cut by SpeI and NotI) was replaced by a TRE3G promoter fragment using In-fusion cloning. Subsequently, KRAB-dCas9-ecDHFR and IRES-EGFP fragments were inserted downstream of the TRE3G promoter (NotI).
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; piggyBAC
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-ecDHFR
  • Species
    Synthetic
  • Insert Size (bp)
    4977
  • Promoter TRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTTAGGCGTGTACGGTGGG
  • 3′ sequencing primer cctaggaatgctcgtcaaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro was a gift from Azim Surani (Addgene plasmid # 183410 ; http://n2t.net/addgene:183410 ; RRID:Addgene_183410)
  • For your References section:

    Sequential enhancer state remodelling defines human germline competence and specification. Tang WWC, Castillo-Venzor A, Gruhn WH, Kobayashi T, Penfold CA, Morgan MD, Sun D, Irie N, Surani MA. Nat Cell Biol. 2022 Apr;24(4):448-460. doi: 10.1038/s41556-022-00878-z. Epub 2022 Apr 11. 10.1038/s41556-022-00878-z PubMed 35411086