pUltra-MDH1-ME1
(Plasmid #184465)

• Purpose: Lentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)
• Depositing Lab: Gerardo Ferbeyre
• Publication: Igelmann et al Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028.

Backbone

• Vector backbone: pUltra
• Backbone manufacturer: obtained from Addgene (#24129)
• Backbone size w/o insert (bp): 8326
• Total vector size (bp): 11021
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Malate dehydrogenase 1
• Alt name: MDH1
• Species: H. sapiens (human)
• Insert Size (bp): 1002
• Mutation: deletion of stop codon
• GenBank ID: NM_005917
• Promoter: UbC
• Tag / Fusion Protein:
  • fused to T2A

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ggatctggagcaacaaacttc
• 3′ sequencing primer: tagctgggccgggattttc

Gene/Insert 2

• Gene/Insert name: Malic Enzyme 1
• Species: H. sapiens (human)
• Insert Size (bp): 1719
• GenBank ID: NM_002395
• Entrez Gene: ME1 (a.k.a. HUMNDME, MES)
• Promoter: UbC

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: gagggcaggggaagtctac
• 3′ sequencing primer: gtatccacatagcgtaaaagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The sequence for the ME1 was from Addgene Plasmid #49163

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry