pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
(Plasmid #184549)

• Purpose: Retroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tag
• Depositing Lab: Gerardo Ferbeyre
• Publication: Igelmann et al Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028.

Backbone

• Vector backbone: pLPC
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6080
• Total vector size (bp): 8892
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Malate dehydogenase 1
• Alt name: MDH1
• Species: H. sapiens (human)
• Insert Size (bp): 1074
• GenBank ID: NM_005917
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: taggcgtgtacggtggga
• 3′ sequencing primer: CTCAAGCGTATTCAACAAGGG

Gene/Insert 2

• Gene/Insert name: Malic Enzyme 1
• Species: H. sapiens (human)
• Insert Size (bp): 1746
• GenBank ID: NM_002395
• Entrez Gene: ME1 (a.k.a. HUMNDME, MES)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA tag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII / BamHI (destroyed during cloning)
• 3′ cloning site: Xho I /Sal I (destroyed during cloning)
• 5′ sequencing primer: CCCTTGTTGAATACGCTTGAG
• 3′ sequencing primer: acctgtaggtttggcaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ME1 was from (Addgene plasmid #49163)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry