pBABE-neomycin-PC-MYC
(Plasmid
#184550)
-
PurposeRetroviral vector to express human PC with MYC tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBABE-neo
-
Backbone manufacturerAddgene plasmid # 1764
- Backbone size w/o insert (bp) 5169
- Total vector size (bp) 8825
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePyruvate Carboxylase
-
Alt namePC, PCB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3535
-
GenBank IDNM_000920
-
Entrez GenePC (a.k.a. PCB)
- Promoter LTR
-
Tag
/ Fusion Protein
- MYC (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcGttcgac
- 3′ sequencing primer agcaaccaggtgtggaaagtcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence for PC was from OriGene CAT#: SC122580
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE-neomycin-PC-MYC was a gift from Gerardo Ferbeyre (Addgene plasmid # 184550 ; http://n2t.net/addgene:184550 ; RRID:Addgene_184550) -
For your References section:
A hydride transfer complex reprograms NAD metabolism and bypasses senescence. Igelmann S, Lessard F, Uchenunu O, Bouchard J, Fernandez-Ruiz A, Rowell MC, Lopes-Paciencia S, Papadopoli D, Fouillen A, Ponce KJ, Huot G, Mignacca L, Benfdil M, Kalegari P, Wahba HM, Pencik J, Vuong N, Quenneville J, Guillon J, Bourdeau V, Hulea L, Gagnon E, Kenner L, Moriggl R, Nanci A, Pollak MN, Omichinski JG, Topisirovic I, Ferbeyre G. Mol Cell. 2021 Sep 16;81(18):3848-3865.e19. doi: 10.1016/j.molcel.2021.08.028. 10.1016/j.molcel.2021.08.028 PubMed 34547241