Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CAG-LiLac
(Plasmid #184570)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184570 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CAG
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LiLac fluorescent sensor of lactate
  • Species
    Synthetic
  • Insert Size (bp)
    1557
  • Promoter CAG
  • Tag / Fusion Protein
    • His7 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

mTurquoise2 sequences are originally from Goedhart, J. et al. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%. Nat Commun 3, 751 (2012) and were obtained by PCR from the plasmid encoding the Lck-cpmTq2-Calcium-lifetime-sensor (Addgene plasmid #129627) (A turquoise fluorescence lifetime-based biosensor for quantitative imaging of intracellular calcium. van der Linden FH, Mahlandt EK, Arts JJG, Beumer J, Puschhof J, de Man SMA, Chertkova AO, Ponsioen B, Clevers H, van Buul JD, Postma M, Gadella TWJ Jr, Goedhart J. Nat Commun. 2021 Dec 9;12(1):7159. doi: 10.1038/s41467-021-27249-w.)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-LiLac was a gift from Gary Yellen (Addgene plasmid # 184570 ; http://n2t.net/addgene:184570 ; RRID:Addgene_184570)
  • For your References section:

    A high-throughput multiparameter screen for accelerated development and optimization of soluble genetically encoded fluorescent biosensors. Koveal D, Rosen PC, Meyer DJ, Diaz-Garcia CM, Wang Y, Cai LH, Chou PJ, Weitz DA, Yellen G. Nat Commun. 2022 May 25;13(1):2919. doi: 10.1038/s41467-022-30685-x. 10.1038/s41467-022-30685-x PubMed 35614105