Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

cyt-GafD-mTurboID-V5
(Plasmid #184640)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184640 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5372
  • Total vector size (bp) 6722
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cyt-GlycoID-V5
  • Alt name
    cytosol targeted GafD (22-178)--miniTurboID (BirA*), V5-tagged
  • Species
    Escherichia coli
  • Insert Size (bp)
    1347
  • Mutation
    GafD -> expressed aa22-178 ; BirA* -> expressed the miniTurboID variant (Alice Ting Lab)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Nuclear export sequence (C terminal on insert)
    • V5 tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer TurboID reverse: TGTTTATCAATCCCCCGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cyt-GafD-mTurboID-V5 was a gift from Charlie Fehl (Addgene plasmid # 184640 ; http://n2t.net/addgene:184640 ; RRID:Addgene_184640)
  • For your References section:

    Spatiotemporal Proximity Labeling Tools to Track GlcNAc Sugar-Modified Functional Protein Hubs during Cellular Signaling. Liu Y, Nelson ZM, Reda A, Fehl C. ACS Chem Biol. 2022 Jul 12. doi: 10.1021/acschembio.2c00282. 10.1021/acschembio.2c00282 PubMed 35819414