nuc-GafD-mTurboID-HA
(Plasmid #184641)

• Purpose: Expresses 3xHA-tagged GlycoID construct: GafD_short-miniTurboID in mammalian nucleus for O-GlcNAc interactome tagging
• Depositing Lab: Charlie Fehl
• Publication: Liu et al ACS Chem Biol. 2022 Jul 12. doi: 10.1021/acschembio.2c00282.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 6809
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nuc-GlycoID-HA
• Alt name: nucleus targeted GafD (22-178)--miniTurboID (BirA*), HA-tagged
• Species: Escherichia coli
• Insert Size (bp): 1440
• Mutation: GafD -> expressed 22-178 ; BirA* -> expressed the miniTurboID variant (Alice Ting Lab)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Nuclear localization sequence (C terminal on insert)
  • 3xHA tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV forward
• 3′ sequencing primer: TurboID reverse: TGTTTATCAATCCCCCGGCT

Resource Information

• Supplemental Documents:
  • nuc-GafD-mTurboID-HA_theoretical.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry