Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #184652)


Item Catalog # Description Quantity Price (USD)
Plasmid 184652 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5727
  • Total vector size (bp) 7255
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Kat5 (a.k.a. AI839539, CPLA2, Htatip, Htatip1, PLIP, Tip55, Tip60)
  • Promoter CMV
  • Tag / Fusion Protein
    • MYC (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGATCCGCGGAGGTGGGGGAGATA
  • 3′ sequencing primer AAGCTAGCTTGCCAAACCTACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPC-MYC.Mm.KAT5 was a gift from Agnel Sfeir (Addgene plasmid # 184652 ; ; RRID:Addgene_184652)
  • For your References section:

    Rap1 regulates TIP60 function during fate transition between two-cell-like and pluripotent states. Barry RM, Sacco O, Mameri A, Stojaspal M, Kartsonis W, Shah P, De Ioannes P, Hofr C, Cote J, Sfeir A. Genes Dev. 2022 Feb 24. pii: gad.349039.121. doi: 10.1101/gad.349039.121. 10.1101/gad.349039.121 PubMed 35210222