Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPgiCas13b
(Plasmid #184833)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184833 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD33
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 7400
  • Modifications to backbone
    Arabinose cassette exchanged with insert
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas13b nuclease from Porphyromonas gingivalis
  • Alt name
    PgiCas13b
  • Species
    Porphyromonas gingivalis
  • Insert Size (bp)
    3360
  • GenBank ID
    AJW4
  • Promoter T7 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaaccttcgaaaaaccgccc
  • 3′ sequencing primer actcagaagtgaaacgccgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPgiCas13b was a gift from Chase Beisel (Addgene plasmid # 184833 ; http://n2t.net/addgene:184833 ; RRID:Addgene_184833)
  • For your References section:

    Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413