pQE-80L 2xHis-LRRK2 Armadillo 1-159
(Plasmid
#186016)
-
Purpose2xHis-LRRK2 Armadillo 1-159
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-80L
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2xHis-LRRK2 Armadillo 1-159
-
SpeciesH. sapiens (human)
-
MutationSee depositor's comments below.
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGATAACAATTTCACACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note this plasmid contains a R68H mutation in the insert. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE-80L 2xHis-LRRK2 Armadillo 1-159 was a gift from Suzanne Pfeffer (Addgene plasmid # 186016 ; http://n2t.net/addgene:186016 ; RRID:Addgene_186016) -
For your References section:
A feed-forward pathway drives LRRK2 kinase membrane recruitment and activation. Vides EG, Adhikari A, Chiang CY, Lis P, Purlyte E, Limouse C, Shumate JL, Spinola-Lasso E, Dhekne HS, Alessi DR, Pfeffer SR. Elife. 2022 Sep 23;11:e79771. doi: 10.7554/eLife.79771. 10.7554/eLife.79771 PubMed 36149401