pCF806-shRen.713
(Plasmid
#186712)
-
PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCF806
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRen.713
-
gRNA/shRNA sequencetagataagcattataattccta
-
SpeciesRenilla luciferase
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCF806-shRen.713 was a gift from Christof Fellmann (Addgene plasmid # 186712 ; http://n2t.net/addgene:186712 ; RRID:Addgene_186712) -
For your References section:
Endogenous spacing enables co-processing of microRNAs and efficient combinatorial RNAi. Amen AM, Loughran RM, Huang CH, Lew RJ, Ravi A, Guan Y, Schatoff EM, Dow LE, Emerling BM, Fellmann C. Cell Rep Methods. 2022 Jun 21;2(7):100239. doi: 10.1016/j.crmeth.2022.100239. eCollection 2022 Jul 18. 10.1016/j.crmeth.2022.100239 PubMed 35880017