Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRRL-5xTetO-pEF-H2B-Citrine-SV40
(Plasmid #186966)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186966 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 5474
  • Total vector size (bp) 8633
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Citrine (fluorescence)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5xTetO-pEF-H2B-Citrine-SV40
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    3211
  • Promoter 5xTetO-pEF-1alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer cPPT-SF ATAGTAGACATAATAGCAACAGACATAC
  • 3′ sequencing primer Citrine-SF CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The 5xTetO-pEF-H2B-Citrine-SV40 insert was amplified from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins, a gift from M. Elowitz (Addgene #78099). The pRRL vector backbone was prepared by restriction digest of LT3REVIR, a gift from J. Zuber (Addgene #111176).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL-5xTetO-pEF-H2B-Citrine-SV40 was a gift from Brian Liau (Addgene plasmid # 186966 ; http://n2t.net/addgene:186966 ; RRID:Addgene_186966)
  • For your References section:

    Base editor scanning charts the DNMT3A activity landscape. Lue NZ, Garcia EM, Ngan KC, Lee C, Doench JG, Liau BB. Nat Chem Biol. 2023 Feb;19(2):176-186. doi: 10.1038/s41589-022-01167-4. Epub 2022 Oct 20. 10.1038/s41589-022-01167-4 PubMed 36266353